Pcmv3-sp-n-his
Splet28. dec. 2024 · Part Number: SMP-V253. $6.99. Standard Motor PCV Valves. PCV Valve, Chrysler, Dodge, Plymouth, Each. See More Specifications Check the Fit. Estimated Ship … SpletpCMV3-SP-N-His Mammalian expression vector: Protein expression will be driven by the CMV promoter with N terminally fused His tag. The vector is specially suitable for … Here you can find our complete kits for gene knockout via CRISPR.All products … Expression vectors, like cloning vectors, are used for horizontal gene … A plasmid is a small, circular, double-stranded DNA molecule within a cell that … antibodies-online Inc. Jones Boulevard 321 Limerick, PA 19464 United States Phone …
Pcmv3-sp-n-his
Did you know?
SpletVector : pCMV3-SP-N-His Shipping carrier : Each tube contains approximately 10 μg of lyophilized plasmid. Storage : The lyophilized plasmid can be stored at ambient temperature for three months. Quality control : The plasmid is confirmed by full-length sequencing with primers in the sequencing primer list. Sequencing primer list : SpletMERS-CoV was first discovered in Saudi Arabia in September 2012. It is similar to the SARS virus in its clinical symptoms. It was also named SARS-like virus in the early days. It is the sixth known human coronavirus. MERS-CoV is often confused with SARS, but in fact both viruses belong to the coronavirus, but they are genetically distinct and ...
SpletpCMV3–untagged: Vector Size: 6166bp: Vector Type: Mammalian Expression Vector: Expression Method: Constitutive, Stable / Transient: Promoter: CMV: Antibiotic … SpletSchematic of pCMV3-SP-N-His Multiple Cloning Sites Vector Name pCMV3-SP-N-His Vector Size 6149bp Vector Type Mammalian Expression Vector Expression Method …
SpletFLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild … SpletpCMV3-SP-N-HA is recommended for constructing the N-HA tag secretary and membrane proteins expression vector which containing a naïve signal peptide. An universal signal peptide is used to instead the naïve signal peptide. HA Tag Information
Splet• pCMV3-SP-N-His More Reagents and Services • cDNA / Clones • qPCR Primer • Transfection Reagent Sino Biological, Inc. (China) Building 9, Jing Dongbei Technology Park, No.18 Kechuang 10th St, BDA, Beijing, 100176, P.R.China Sino Biological US Inc. (U.S.A.) Pennsylvania Office: 1400 Liberty Ridge Drive, Suite 101, Wayne, PA 19087
SpletFor galectin-1 overexpression, 0.7μg pCMV3-SP-N-His-Gal-1 plasmid or negative control pCMV3-SP-N-His plasmid and 20μl HiPerFect transfection reagent were diluted separately in 40μl OPTI-MEM at room temperature for 5 minutes. The two mixtures were re-mixed and incubated for 30 minutes. long-term memories are storedSpletHuman BOLA1 Expression-Ready ORF Clone LS-N36753 is cloned in pCMV3-SP-N-His containing tag (His, N-terminus). This construct is used in a Mammalian expression … long term memorization techniquesSpletpCMV3-SP-N-His: Vector Size: 6089bp: Vector Type: Mammalian Expression Vector: Expression Method: Constitutive, Stable / Transient: Promoter: CMV: Antibiotic … long term melatonin use hazardsSpletEnhanced CMV promoter Vector pCMV3-SP-N-His Restriction Sites KpnI + XbaI (6kb + 0.39kb) Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC Sequencing Primers T7 ( 5' TAATACGACTCACTATAGGG 3' ) BGH ( 5' TAGAAGGCACAGTCGAGG 3' ) Quality Control The plasmid is confirmed by full-length … hop hing mentor ohSpletExpression Vector pCMV3-SP-N-Flag Information Description pCMV3-SP-N-Flag is recommended for constructing the N-flag tag secretary and membrane proteins expression vector which containing a naïve signal peptide. An universal signal peptide is used to instead the naïve signal peptide. Flag Tag Information long term memorizationSpletA Myc tag is a polypeptide protein tag derived from the c-Myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. long term memory analogy notes librarySpletSino Biological은 재조합 Recominant protein, Antibody, ELISA kit 등과 같은... long-term memory analogy file cabinet