Mcf7 trop2
WebTROP2 is a carcinoma-associated antigen defined by the monoclonal antibody GA733. This antigen is a member of a family including at least two type I membrane proteins. It transduces an intracellular calcium signal and acts as a cell surface receptor. Web10 nov. 2024 · MCF7 growth required supplementation with slow-release estrogen pellets, whereas the endocrine-resistant MCF7-F cell line grows independently of estrogen and …
Mcf7 trop2
Did you know?
Web31 dec. 2024 · TROP2 stimulates proliferation and cellular growth in human cervical and bladder cancer cells, while the ability of TROP2 to suppress cell proliferation was also … Web12 jan. 2024 · The TROP2-knockout cell line, MCF7/TROP2-KO (BINDS-29), was established by transfecting CRISPR/Cas9 plasmids for TROP2 into MCF7 cells using the …
WebMCF7 cells were stained with Anti-TROP2 antibodies or with the corresponding REA Control (S) antibodies (left peak). Flow cytometry was performed using the MACSQuant ® … WebAnti-Trop2, clone 2G10, Azide Free Antibody clone 2G10, from mouse; Synonyms: Tumor-associated calcium signal transducer 2, Cell surface glycoprotein Trop-2, Membrane …
WebNational Center for Biotechnology Information WebThe TROP2 gene-knockout cell line, MCF7/TROP2-KO (BINDS-29), was previously generated by transfection of CRISPR/Cas9 plasmids targeting TROP2...
http://www.med-tohoku-antibody.com/file/reference/1-s2.0-S2405580820302120-main.pdf
Web1 feb. 2024 · Trop2 deal heats up antibody–drug conjugate space in cancer @article{Shaffer2024Trop2DH, title= ... CHO/TROP2 and the three breast cancer cell … children\u0027s craft activities ideasWeb30 sep. 2008 · B, mRNA levels of CYCLIN D1, TROP2, and CYCLIN D1-TROP2 chimera in the MCF7 shRNA transfectants, as measured by Sybr Green RT-PCR. Plots of emission … governo whatsappWebImmunogen Tissue, cells or virus corresponding to Human TROP2. Human choriocarcinoma cell line BeWo. Positive control IHC-P: Human placenta tissue. ICC/IF: JEG3 and MCF7 … governo wilson limaWebDetection of TROP2 on human breast cancer cell line MCF7. MCF7 cells were treated with 67 nM of the human TROP2 antibody (catalog # MAB650) or mouse IgG2a isotype … children\u0027s craft for romans 8MCF7 was a kind gift from Dr. James Brooks’s laboratory at Stanford University (Palo Alto, CA). HCC1806 cells were purchased from ATCC. Cells were grown in RPMI supplemented with 10% fetal bovine serum, 1% penicillin/streptomycin, and 1% Glutamax. Cell culture was performed in a 37 °C incubators … Meer weergeven The TMA was purchased from Biomax (BR1505c) including 150 breast invasive ductal carcinoma cores from 75 different patients with duplicate cores per patient. The TMA had information regarding the clinical stages … Meer weergeven Totally, 400 cells/well for MCF7 and 500 cells/well for HCC1806 cell lines were plated in 6-well plates in triplicates and cultured for 12 days with media changing every 3 days. … Meer weergeven FUCRW plasmid was a generous gift from Dr. Owen Witte’s laboratory at the University of California Los Angeles. The FUCRW-Trop2-OV construct generation was … Meer weergeven The generation of Trop2 knockout stable clone with the guide RNA sequence: CACCAGCGTGCGGGCGTTCT by CRISPR/Cas9 system was previously described34. … Meer weergeven children\\u0027s craft ideasWeb4 okt. 2024 · Most epithelial cells, including MCF7 cells, also express Trop2, a close relative of EpCAM. Intriguingly, we found that Trop2 depletion led to the exact opposite global … governo thatcherWebTrophoblast cell surface antigen 2 (TROP2), reported to be overexpressed in several types of cancer, is involved in cell proliferation, invasion, metastasis, and poor prognosis of … govern sentence